[Frontiers in Bioscience E4, 2476-2489, June 1, 2012]
2476
Very early-initiated physical rehabilitation protects against ischemic brain injury
Pengyue Zhang1, Qi Zhang1, Hongjian Pu1, Yi Wu1, Yulong Bai1, Peter S. Vosler2, Jun Chen1, 2, Hong Shi1, Yanqin Gao1,
Yongshan Hu1
1Department of Rehabilitation of Huashan Hospital, State Key Laboratory of Medical Neurobiology, Department of Sports
Medicine and Rehabilitation, The Yonghe Branch of Huashan Hospital, and Institute of Brain Sciences, Fudan University,
Shanghai 200032, China, 2Department of Neurology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261, USA
TABLE OF CONTENTS
1. Abstract
2. Introduction
3. Materials and methods
3.1. Animal model of transient focal cerebral ischemia
3.2. Treadmill training
3.3. Tissue section preparation
3.4. Measurement of infarct volume
3.5. Immunofluorescence staining and image analysis
3.6. Tissue processing and total RNA extraction
3.7. Reverse transcription and semi-quantitative real-time RT-PCR
3.8. Blood–brain barrier permeability evaluation
3.9. Brain water content determine
3.10. Behavioral training and evaluations
3.11. Statistical analysis
4. Results
4.1. Physiological Variables
4.2. VEIPR reduced infarct volume
4.3. VEIPR inhibited the activation of astrocytes and microglia cells
4.4. VEIPR suppressed proinflammatory cytokine and cell adhesion molecule mRNA expression after tFCI
4.5. VEIPR improves BBB integrity and decreases brain edema after tFCI
4.6. VEIPR promotes functional recovery
4.6.1. Neurological deficits
4.6.2. Motor function
4.6.3. Spatial learning and memory
5. Discussion
6. Acknowledgements
7. References
1. ABSTRACT
Recent clinical data suggest that very early initiated
physical rehabilitation (VEIPR) within 24 hours after stroke
may reduce morbidity. However, there is limited evidence to
support the beneficial effects of VEIPR and the underlying
mechanisms are yet unknown. The present study investigated
the effect of VEIPR on brain damage, inflammation, and
neurobehavioral outcomes following cerebral ischemia. Rats
that underwent transient focal cerebral ischemia (tFCI) were
randomly assigned to VEIPR or non-exercise (NE) groups.
VEIPR was induced 24 hours after the insult by initiating
treadmill training for a maximum of 14 days while the NE
group remained sedentary in their cages during this period. The
results indicated that VEIPR significantly improved recovery
of functional behavior as measured by neurological score, foot
fault test, and Morris water maze performance. We also
demonstrated that VEIPR significantly reduced infarct volume,
brain water content, BBB damage, and acute inflammatory
response. In summary, our results provide novel evidence that
VEIPR confers marked neuroprotection against experimental
stroke by attenuating pro-inflammatory reactions, brain edema,
BBB damage, and cognitive and behavioral deficits.
2. INTRODUCTION
Stroke is a major cause of mortality and chronic
neurological disability worldwide (American Heart
Association, 2009(1)). Most survivors from stroke suffer
from motor disability, cognitive dysfunction, and problems
in learning and behavior that reduce their ability to perform
activities of daily living and thus reduce their quality of life
(2, 3). In the past decades, there has been a rapidly growing
understanding of the mechanisms underlying the
pathophysiology of stroke, increasing novel therapeutic targets
have been identified, and thousands of drugs have been tested
in various animal models. Although those breakthroughs lead
to abundant therapeutics and drugs which have been
undergone clinical trials, to date, the therapeutic options for
acute ischemic stroke remain very limited (4, 5). Recombinant
tissue plasminogen activator (tPA) is currently the only agent
shown to improve stroke outcome in clinical trials, but its use
is limited by its narrow therapeutic window and risk of
hemorrhage (6, 7). Consequently, the optimum treatment of
acute ischemic stroke remains one of the major challenges in
clinical medicine. It is therefore essential to discover
therapeutic strategies that improve clinical outcomes.
VEIPR protects against ischemic brain injury
2477
Physical exercise after stroke is an effective
approach of clinic rehabilitation, as it has been shown to
reduce the rate of cognitive decline (8), enhance
sensorimotor control (9), promote walking speed and
capacity (10, 11), and improve life quality of stroke
patients (12,13). In animal studies, physical exercise
initiated subacutely and at delayed stage following cerebral
ischemia reduced infarct size and ischemia-induced
apoptosis of neuronal cells (14), improved motor function
(15,16), and promoted learning and memory performance
(17). The possible mechanisms involved upregulation of
proteins such as BDNF and CREB (18), increased
hippocampal dendritic spine density (19), and enhanced
synaptogenesis (20, 21) and neurogenesis(22).
Despite massive beneficial evidences of physical
exercise had been reported, the effect of very early initiated
physical rehabilitation (VEIPR) remains controversial (23,
24). Some reports showed that exercise performed soon
after cerebral ischemia produced detrimental effects on
functional recovery and neurogenesis (25-28), while others
suggested that VEIPR decreased tissue injury and improved
functional outcome in experimental stroke rats (29,30).
Recent clinical data show that VEIPR following stroke may
offer beneficial effects in stroke patients (31). Indeed,
VEIPR is recommended in plenty of stroke units (32), and
has been included in the Clinical Guidelines for Stroke
Management 2010 document sponsored by the National
Stroke Foundation in Australia (33).
In view of the disparate information regarding
the efficacy of VEIRP, we sought to evaluate the
neuroprotective effect of VEIPR following experimental
stroke. In the present study, we examined the effect of
VEIPR on the sequelae of transient forebrain ischemia
(tFCI). Our results support our hypothesis that VEIPR
confers marked neuroprotection against focal ischemic
brain injury in rats by attenuating infarct volume,
suppressing reactive astrocytosis and production of
proinflammatory cytokines, reducing brain edema, and
blood brain barrier damage after ischemia and reperfusion.
3. MATERIALS AND METHODS
3.1. Animal model of transient focal cerebral ischemia
Adult male Sprague-Dawley rats (250-270g,
Shanghai SLAC Laboratory Animal Co. Ltd.) were used as
subjects. All rats were housed under a 12h light/dark cycle
with food and water available ad libitum throughout the
study. After behavioral training, tFCI was induced by left
middle cerebral artery occlusion (MCAO) as previously
described (34). Briefly, rats were anesthetized with 1.5%
isoflurane (Abbott, U.S.A) and mechanically ventilated via
an endotracheal tube. After a midline cervical incision, the
left common carotid artery was exposed and the external
carotid artery was ligated distally. To occlude the origins of
the MCA, a 4-0 nylon monofilament coated with a silicone
tip was inserted into the internal carotid artery and
advanced 1.9-2.0 cm from the bifurcation site. After 60
min, reperfusion was reestablished by withdrawal of the
filament. Through the cannulated left femoral artery,
physiologic variables (blood pressure, blood gases) were
monitored before, during, and after ischemia. To confirm
the success of the model, changes in regional cerebral
blood flow (rCBF) before, during, and after tFCI were
recorded by laser Doppler flowmetry. Criteria used to
determine successful cerebral ischemia included a drop in
the rCBF of more than 80% during ischemia and ascension
to more than 90% of the baseline rCBF after reperfusion.
Rectal temperature was maintained at 37.0°C by a
thermostat-controlled heating blanket. For the sham control
group, all steps were included except for the insertion of
the filament into the carotid artery. All procedures were
performed according to the Animal Experimental
Committee of Fudan University at Shanghai, China.
3.2. Treadmill training
Prior to tFCI and sham surgery, all rats were
habituated to the motorized treadmills at a speed of 6-9
m/min for 3 consecutive days (10 min per day). To evaluate
the effect of VEIPR on behavioral recovery, rats were
randomly assigned to one of the following three groups: the
VEIPR group (n=10), the non-exercise (NE) group (n=10),
and the sham group (n=6). Animals in the VEIPR group
were induced by forced treadmill training on an electric
treadmill (Litai Biotechnology Co., Ltd, China) for 14
consecutive days initiated at 24 hour post tFCI. The
exercise velocity and duration was gradually increased with
the following schedule: Day 1, 5 m/min for the first 10 min,
9 m/min for 10 min, and 12m/min for the last10 min; Day
2, 5 m/min for the first 5 mins, 9 m/min for 5 min, and 12
m/min for last 20 min; Day 3 (training goal) through Day
14, 12 m/min for 30 min. The slope was set at 0° for all
phases of training. The rats in the NE and sham groups
were placed on stationary treadmills for the same duration.
All of the time points for the subsequent tests are depicted
in Figure 1.
3.3. Tissue section preparation
At day 3 and 7 post tFCI (Figure 1), animals
were anaesthetized with chloral hydrate (360 mg/kg, i.p.)
and transcardially perfused with saline followed by 4%
paraformaldehyde in 0.1 M phosphate buffer (pH 7.4).
Thereafter, brains were removed and transferred into a 20%
sucrose solution in PBS overnight for cryoprotection.
Frozen serial coronal brain sections were sliced on a
cryostat (30 µm in thickness).
3.4. Measurement of infarct volume
Frozen coronal brain sections (total 10 slices
over a 360-µm interval with every 12th section used for
analysis) from rats on day 7 post tFCI were taken for
determination of infarct volume using the MAP2 staining
method (35). Briefly, slices were treated with 0.3 %
hydrogen peroxide to block endogenous peroxidase
activity, then incubated with 10 % normal goat serum
(Jackson ImmunoResearch Laboratories, U.S.A.) followed
by incubated monoclonal rabbit antibodies against MAP2
(Millipore, 1:800, overnight at 4°C). The following day
slices were incubated with a biotinylated goat anti-rabbit
IgG secondary antibody (KPL, 1:200) for 1 hour, followed
by a preformed avidin-horseradish peroxidase complex
(Vectastain Elite ABC-Reagent, Vector) for 30 min.
Immunostaining was developed using diaminobenzidine
VEIPR protects against ischemic brain injury
2478
Figure 1. Schematic illustration of the experimental design. Foot fault and treadmill training were performed prior to surgery at
separate times for 4 and 3 consecutive days, respectively. On day 1 after the operation, rats in the VEIPR group were subjected to
the tread mill exercise protocol described in the materials and methods section until day 14. * Represent the foot fault test (F-F)
and neurological score (NS) testing days. # represent the days when rats were sacrificed to obtain measurements of pro-
inflammatory cytokines (RT-PCR). ** represent immunofluorescence (IF) analysis. Infarct volume, blood-brain-barrier (BBB)
permeability and brain water content (edema) are indicated as ## on the figure. Evaluation of spatial learning using the Morris
water maze and measuring the latency for the rat to find the submerged platform started on day 21 and continued each day until
day 24 post tFCI. Spatial memory was evaluated on day 25 using the probe test where the platform was removed and the amount
of time the rats spent in the correct quadrant was measured. Abbreviations: tFCI, transient focal cerebral ischemia; MWM,
Morris water maze; RT-PCR, reverse transcriptase polymerase chain reaction.
(Sigma-Aldrich). All the sections were digitized with a
microscope (Nikon, Japan) using the same magnification.
The area of non-MAP2 staining was defined as the infarct
zone. For each tissue section the area of remaining tissue
(MAP2 positive staining) was traced using NIH Image
software (available at: http://rsb.info.nih.gov/nih-image/).
The percentage of infarct volume was determined
according to the following equation: (MAP-2 positive area
of ischemic hemisphere)/ (MAP-2 positive area of
nonischemic hemisphere) X 100%. The results were
presented as mean ± SE.
3.5. Immunofluorescence staining and image analysis
Mouse monoclonal anti-GFAP antibody (Cell
Signaling Technology, U.S.A.), and rabbit anti-Iba-1
antibody (Wako, Japan) were used as the primary
antibodies in this study. Brain sections processed
according to section 3.3 on days 3 and 7 post tFCI were
incubated with primary antibodies for 1 hour at 37°C and
then at 4°C overnight, followed by incubation for 1 hour at
37°C with DyLightTM 594-conjugated goat anti- mouse
and DyLightTM 488-conjugated goat anti- rabbit secondary
antibody (Jackson ImmunoResearch Laboratories, U.S.A.).
Sections were then counterstained with DAPI (Thermo
Scientific, U.S.A.) for 2 min at room temperature followed
by mounting with fluoromount-G (Southern Biotech,
U.S.A.). For densitometric analysis a computerized camera
based NIH Image-analysis system software (available at:
http://rsb.info.nih.gov/nih-image/) was used as previously
described (36). Briefly, areas of interest focusing in
ischemic penumbra were digitized to TIFF images under
the same exposure time. The images were then binarized
and segmented under a consistent threshold (50%). Next,
the total black pixels per image were counted. In order to
minimize the differences of fluorescent intensity among
immunostained sections, pixels values were calculated as
ratios of injury in the ipsilateral (IL) relative to the
contralateral (CL) hemisphere (IL: CL = lesion: intact
hemisphere). The results used for analysis were presented
as pixels of IL: CL.
3.6. Tissue processing and total RNA extraction
At day 3, 5, and 7 post tFCI (Figure 1), rats
underwent their indicated exercise protocol were given 2
hour of rest. Thereafter they were sacrificed by
decapitation under deep chloral hydrate (360 mg/kg, i.p.)
anesthesia. The brain was quickly removed and the
infarcted core and penumbra in hemisphere with the lesion
was isolated on ice followed by immediate freezing in dry
ice and stored at -80°C. Total RNA was extracted by
homogenization with Trizol reagent (Applied Biosystems,
USA) in accordance with the manufacturer’s protocol.
RNA quantity was determined by optical density
measurement and prepared for cDNA synthesis.
3.7. Reverse transcription and semi-quantitative real-
time RT-PCR
The reverse transcription was conducted with a
RT reagent kit (Agilent, U.S.A.) in accordance with the
manufacturer’s protocol. PCR analyses were performed
with gene-specific primers (Table 1), and the endogenous
control was glyceraldehyde-3-phosphate dehydrogenase
(GAPDH). Real-time data were analyzed with a
Mastercycler® realplex analysis system (Eppendorf,
Hamburg, Germany). All samples were performed in
triplicate. Thermal cycling condition was set according to
the manufacturer’s recommendations. Relative
quantification of target mRNA was normalized to GAPDH
expression with the comparative cycle threshold (Ct)
method (37). The relative fold change of target gene
expression was expressed as 2-∆∆Ct, where ∆∆Ct = ∆Ct test
animal −∆Ct calibrator animal. Three animals in the sham group
were randomly chosen as the calibrator sample. The ∆Ct
was defined as Ct target −Ct GAPDH.
3.8. Blood brain barrier permeability evaluation
Blood brain barrier permeability was determined
by Evans blue (EB) extravasation at day 7 post tFCI.
Briefly, EB (2% in 0.01M PBS; 5 mL/kg) was slowly
administered i.v. Three hours after dye administration
VEIPR protects against ischemic brain injury
2479
Table 1. List of primers used in this study
Gene Forward 5’-3’ Reverse 5’-3’
IL1-alpha CCAAAGTTCCTGACTTGTTTG GAAGGTGAAGGTGGACATC
IL1-beta CTGTCCCTGAACTCAACTGTG GTCCTCATCCTGGAAGCTCC
IL-6 CAGGGAGATCTTGGAAATGAG GTTGTTCTTCACAAACTCC
iNOS GGAAGTTTCTCTTCAGAGTC CGATGGAGTCACATGCAGC
COX2 GACAGATCAGAAGCGAGGACCTG GTAGATCATGTCTACCTGAGTG
TNF-alpha GATCGGTCCCAACAAGGAGG GCTGGTACCACCAGTTGGTTG
VCAM-1 GGCTCGTACACCATCCGC CGGTTTTCGATTCACACTCGT
ICAM-1 AAACGGGAGATGAATGGTACCTAC TGCACGTCCCTGGTGATACTC
GAPDH GTGAAGGTCGGTGTGAACGG GTTTCCCGTTGATGACCAG
intracardiac perfusion was performed with 300 ml saline to
remove intravascular EB dye. The brains were quickly
removed and dissected into sections of 2 mm thickness for
imaging analysis. To assess the Evans blue (EB)
extravasation, these sections were soaked in methanamide
for 48 hours followed by centrifugation for 30 min at 14000
rpm. The absorption of the supernatant was determined at
632 nm with a spectrophotometer (Bio-Rad). The content
of EB was calculated as µg/g of brain tissue using a
standard curve.
3.9. Brain water content determination
At day 7 post tFCI, rats were killed by
decapitation under deep chloral hydrate (360 mg/kg, i.p.)
anesthesia. The brain was quickly removed and dissected
along the fissure into the ischemic and non-ischemic
hemispheres. Brain tissues was then weighed (wet weight),
and then the brain was heated for 3 days at 100°C in a
drying oven to determine the dry weight. Brain water
content ipsilateral to the lesion was calculated with the
following formula: % H2O = (1-dry wt/wet wt) ×100 %
(38-40).
3.10. Behavioral training and evaluations
3.10.1. Neurological deficits
Neurologic deficits scores were performed at
beginning at day 3 through day 21 post tFCI (Figure 1) as
previously described (41). Each rat was scored according to
a seven points behavioral rating scale: 0, no deficit; 1,
failure to extend right forepaw fully; 2, decreased grip of
the right forelimb when held by tail; 3, spontaneous
movement in all directions, but torso turning to the right
side when held by tail; 4, circling or walking to the right; 5,
walks only when stimulated; 6, no spontaneous activity;
and 7, dead. Animals without a deficit were excluded from
the study. An observer blinded to experiment design
performed neurological testing.
3.10.2. Foot fault test
Measurement of coordinated locomotor
movement of rat forelimb was determined using the foot
fault test as previously described with some modification
(42). Briefly, on a horizontal ladder with a regular
arrangement of rungs (at 2 cm intervals) all rats were
trained for 4 consecutive days before tFCI, and the
baseline score was determined on the day before the
operation. After tFCI, the foot fault test was performed
every 3 days starting from day 3 until day 21 post tFCI
(Figure 1). All animals were trained and tested three
times per session and every session was videotaped for
quantification (only consecutive steps were analyzed).
The quantitative evaluation of
forelimb placement was performed using the following scoring
system: Score 0, total miss, the limb completely missed the
rung; Score 1, deep slip, the forelimb was placed on the rung,
but slipped off and caused a fall; Score 2, slight slip, the
forelimb was placed on a rung, and then slipped off but did not
result in a fall and the rat continued a coordinated gait; Score 3,
replacement, the forelimb was placed on a rung, but then
quickly lifted and placed on another rung before it was weight
bearing; Score 4, correction, the forelimb aimed for one rung,
but was placed on another rung before touching the first one;
Score 5, partial placement, the forelimb was placed on the rung
with wrist digits; Score 6, correct placement, the forelimb was
placed on the rung cor