aa

[Frontiers in Bioscience E4, 2476-2489, June 1, 2012] 2476 Very early-initiated physical rehabilitation protects against ischemic brain injury Pengyue Zhang1, Qi Zhang1, Hongjian Pu1, Yi Wu1, Yulong Bai1, Peter S. Vosler2, Jun Chen1, 2, Hong Shi1, Yanqin Gao1, Yongshan Hu1 1Department of Rehabilitation of Huashan Hospital, State Key Laboratory of Medical Neurobiology, Department of Sports Medicine and Rehabilitation, The Yonghe Branch of Huashan Hospital, and Institute of Brain Sciences, Fudan University, Shanghai 200032, China, 2Department of Neurology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261, USA TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Materials and methods 3.1. Animal model of transient focal cerebral ischemia 3.2. Treadmill training 3.3. Tissue section preparation 3.4. Measurement of infarct volume 3.5. Immunofluorescence staining and image analysis 3.6. Tissue processing and total RNA extraction 3.7. Reverse transcription and semi-quantitative real-time RT-PCR 3.8. Blood–brain barrier permeability evaluation 3.9. Brain water content determine 3.10. Behavioral training and evaluations 3.11. Statistical analysis 4. Results 4.1. Physiological Variables 4.2. VEIPR reduced infarct volume 4.3. VEIPR inhibited the activation of astrocytes and microglia cells 4.4. VEIPR suppressed proinflammatory cytokine and cell adhesion molecule mRNA expression after tFCI 4.5. VEIPR improves BBB integrity and decreases brain edema after tFCI 4.6. VEIPR promotes functional recovery 4.6.1. Neurological deficits 4.6.2. Motor function 4.6.3. Spatial learning and memory 5. Discussion 6. Acknowledgements 7. References 1. ABSTRACT Recent clinical data suggest that very early initiated physical rehabilitation (VEIPR) within 24 hours after stroke may reduce morbidity. However, there is limited evidence to support the beneficial effects of VEIPR and the underlying mechanisms are yet unknown. The present study investigated the effect of VEIPR on brain damage, inflammation, and neurobehavioral outcomes following cerebral ischemia. Rats that underwent transient focal cerebral ischemia (tFCI) were randomly assigned to VEIPR or non-exercise (NE) groups. VEIPR was induced 24 hours after the insult by initiating treadmill training for a maximum of 14 days while the NE group remained sedentary in their cages during this period. The results indicated that VEIPR significantly improved recovery of functional behavior as measured by neurological score, foot fault test, and Morris water maze performance. We also demonstrated that VEIPR significantly reduced infarct volume, brain water content, BBB damage, and acute inflammatory response. In summary, our results provide novel evidence that VEIPR confers marked neuroprotection against experimental stroke by attenuating pro-inflammatory reactions, brain edema, BBB damage, and cognitive and behavioral deficits. 2. INTRODUCTION Stroke is a major cause of mortality and chronic neurological disability worldwide (American Heart Association, 2009(1)). Most survivors from stroke suffer from motor disability, cognitive dysfunction, and problems in learning and behavior that reduce their ability to perform activities of daily living and thus reduce their quality of life (2, 3). In the past decades, there has been a rapidly growing understanding of the mechanisms underlying the pathophysiology of stroke, increasing novel therapeutic targets have been identified, and thousands of drugs have been tested in various animal models. Although those breakthroughs lead to abundant therapeutics and drugs which have been undergone clinical trials, to date, the therapeutic options for acute ischemic stroke remain very limited (4, 5). Recombinant tissue plasminogen activator (tPA) is currently the only agent shown to improve stroke outcome in clinical trials, but its use is limited by its narrow therapeutic window and risk of hemorrhage (6, 7). Consequently, the optimum treatment of acute ischemic stroke remains one of the major challenges in clinical medicine. It is therefore essential to discover therapeutic strategies that improve clinical outcomes. VEIPR protects against ischemic brain injury 2477 Physical exercise after stroke is an effective approach of clinic rehabilitation, as it has been shown to reduce the rate of cognitive decline (8), enhance sensorimotor control (9), promote walking speed and capacity (10, 11), and improve life quality of stroke patients (12,13). In animal studies, physical exercise initiated subacutely and at delayed stage following cerebral ischemia reduced infarct size and ischemia-induced apoptosis of neuronal cells (14), improved motor function (15,16), and promoted learning and memory performance (17). The possible mechanisms involved upregulation of proteins such as BDNF and CREB (18), increased hippocampal dendritic spine density (19), and enhanced synaptogenesis (20, 21) and neurogenesis(22). Despite massive beneficial evidences of physical exercise had been reported, the effect of very early initiated physical rehabilitation (VEIPR) remains controversial (23, 24). Some reports showed that exercise performed soon after cerebral ischemia produced detrimental effects on functional recovery and neurogenesis (25-28), while others suggested that VEIPR decreased tissue injury and improved functional outcome in experimental stroke rats (29,30). Recent clinical data show that VEIPR following stroke may offer beneficial effects in stroke patients (31). Indeed, VEIPR is recommended in plenty of stroke units (32), and has been included in the Clinical Guidelines for Stroke Management 2010 document sponsored by the National Stroke Foundation in Australia (33). In view of the disparate information regarding the efficacy of VEIRP, we sought to evaluate the neuroprotective effect of VEIPR following experimental stroke. In the present study, we examined the effect of VEIPR on the sequelae of transient forebrain ischemia (tFCI). Our results support our hypothesis that VEIPR confers marked neuroprotection against focal ischemic brain injury in rats by attenuating infarct volume, suppressing reactive astrocytosis and production of proinflammatory cytokines, reducing brain edema, and blood brain barrier damage after ischemia and reperfusion. 3. MATERIALS AND METHODS 3.1. Animal model of transient focal cerebral ischemia Adult male Sprague-Dawley rats (250-270g, Shanghai SLAC Laboratory Animal Co. Ltd.) were used as subjects. All rats were housed under a 12h light/dark cycle with food and water available ad libitum throughout the study. After behavioral training, tFCI was induced by left middle cerebral artery occlusion (MCAO) as previously described (34). Briefly, rats were anesthetized with 1.5% isoflurane (Abbott, U.S.A) and mechanically ventilated via an endotracheal tube. After a midline cervical incision, the left common carotid artery was exposed and the external carotid artery was ligated distally. To occlude the origins of the MCA, a 4-0 nylon monofilament coated with a silicone tip was inserted into the internal carotid artery and advanced 1.9-2.0 cm from the bifurcation site. After 60 min, reperfusion was reestablished by withdrawal of the filament. Through the cannulated left femoral artery, physiologic variables (blood pressure, blood gases) were monitored before, during, and after ischemia. To confirm the success of the model, changes in regional cerebral blood flow (rCBF) before, during, and after tFCI were recorded by laser Doppler flowmetry. Criteria used to determine successful cerebral ischemia included a drop in the rCBF of more than 80% during ischemia and ascension to more than 90% of the baseline rCBF after reperfusion. Rectal temperature was maintained at 37.0°C by a thermostat-controlled heating blanket. For the sham control group, all steps were included except for the insertion of the filament into the carotid artery. All procedures were performed according to the Animal Experimental Committee of Fudan University at Shanghai, China. 3.2. Treadmill training Prior to tFCI and sham surgery, all rats were habituated to the motorized treadmills at a speed of 6-9 m/min for 3 consecutive days (10 min per day). To evaluate the effect of VEIPR on behavioral recovery, rats were randomly assigned to one of the following three groups: the VEIPR group (n=10), the non-exercise (NE) group (n=10), and the sham group (n=6). Animals in the VEIPR group were induced by forced treadmill training on an electric treadmill (Litai Biotechnology Co., Ltd, China) for 14 consecutive days initiated at 24 hour post tFCI. The exercise velocity and duration was gradually increased with the following schedule: Day 1, 5 m/min for the first 10 min, 9 m/min for 10 min, and 12m/min for the last10 min; Day 2, 5 m/min for the first 5 mins, 9 m/min for 5 min, and 12 m/min for last 20 min; Day 3 (training goal) through Day 14, 12 m/min for 30 min. The slope was set at 0° for all phases of training. The rats in the NE and sham groups were placed on stationary treadmills for the same duration. All of the time points for the subsequent tests are depicted in Figure 1. 3.3. Tissue section preparation At day 3 and 7 post tFCI (Figure 1), animals were anaesthetized with chloral hydrate (360 mg/kg, i.p.) and transcardially perfused with saline followed by 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). Thereafter, brains were removed and transferred into a 20% sucrose solution in PBS overnight for cryoprotection. Frozen serial coronal brain sections were sliced on a cryostat (30 µm in thickness). 3.4. Measurement of infarct volume Frozen coronal brain sections (total 10 slices over a 360-µm interval with every 12th section used for analysis) from rats on day 7 post tFCI were taken for determination of infarct volume using the MAP2 staining method (35). Briefly, slices were treated with 0.3 % hydrogen peroxide to block endogenous peroxidase activity, then incubated with 10 % normal goat serum (Jackson ImmunoResearch Laboratories, U.S.A.) followed by incubated monoclonal rabbit antibodies against MAP2 (Millipore, 1:800, overnight at 4°C). The following day slices were incubated with a biotinylated goat anti-rabbit IgG secondary antibody (KPL, 1:200) for 1 hour, followed by a preformed avidin-horseradish peroxidase complex (Vectastain Elite ABC-Reagent, Vector) for 30 min. Immunostaining was developed using diaminobenzidine VEIPR protects against ischemic brain injury 2478 Figure 1. Schematic illustration of the experimental design. Foot fault and treadmill training were performed prior to surgery at separate times for 4 and 3 consecutive days, respectively. On day 1 after the operation, rats in the VEIPR group were subjected to the tread mill exercise protocol described in the materials and methods section until day 14. * Represent the foot fault test (F-F) and neurological score (NS) testing days. # represent the days when rats were sacrificed to obtain measurements of pro- inflammatory cytokines (RT-PCR). ** represent immunofluorescence (IF) analysis. Infarct volume, blood-brain-barrier (BBB) permeability and brain water content (edema) are indicated as ## on the figure. Evaluation of spatial learning using the Morris water maze and measuring the latency for the rat to find the submerged platform started on day 21 and continued each day until day 24 post tFCI. Spatial memory was evaluated on day 25 using the probe test where the platform was removed and the amount of time the rats spent in the correct quadrant was measured. Abbreviations: tFCI, transient focal cerebral ischemia; MWM, Morris water maze; RT-PCR, reverse transcriptase polymerase chain reaction. (Sigma-Aldrich). All the sections were digitized with a microscope (Nikon, Japan) using the same magnification. The area of non-MAP2 staining was defined as the infarct zone. For each tissue section the area of remaining tissue (MAP2 positive staining) was traced using NIH Image software (available at: http://rsb.info.nih.gov/nih-image/). The percentage of infarct volume was determined according to the following equation: (MAP-2 positive area of ischemic hemisphere)/ (MAP-2 positive area of nonischemic hemisphere) X 100%. The results were presented as mean ± SE. 3.5. Immunofluorescence staining and image analysis Mouse monoclonal anti-GFAP antibody (Cell Signaling Technology, U.S.A.), and rabbit anti-Iba-1 antibody (Wako, Japan) were used as the primary antibodies in this study. Brain sections processed according to section 3.3 on days 3 and 7 post tFCI were incubated with primary antibodies for 1 hour at 37°C and then at 4°C overnight, followed by incubation for 1 hour at 37°C with DyLightTM 594-conjugated goat anti- mouse and DyLightTM 488-conjugated goat anti- rabbit secondary antibody (Jackson ImmunoResearch Laboratories, U.S.A.). Sections were then counterstained with DAPI (Thermo Scientific, U.S.A.) for 2 min at room temperature followed by mounting with fluoromount-G (Southern Biotech, U.S.A.). For densitometric analysis a computerized camera based NIH Image-analysis system software (available at: http://rsb.info.nih.gov/nih-image/) was used as previously described (36). Briefly, areas of interest focusing in ischemic penumbra were digitized to TIFF images under the same exposure time. The images were then binarized and segmented under a consistent threshold (50%). Next, the total black pixels per image were counted. In order to minimize the differences of fluorescent intensity among immunostained sections, pixels values were calculated as ratios of injury in the ipsilateral (IL) relative to the contralateral (CL) hemisphere (IL: CL = lesion: intact hemisphere). The results used for analysis were presented as pixels of IL: CL. 3.6. Tissue processing and total RNA extraction At day 3, 5, and 7 post tFCI (Figure 1), rats underwent their indicated exercise protocol were given 2 hour of rest. Thereafter they were sacrificed by decapitation under deep chloral hydrate (360 mg/kg, i.p.) anesthesia. The brain was quickly removed and the infarcted core and penumbra in hemisphere with the lesion was isolated on ice followed by immediate freezing in dry ice and stored at -80°C. Total RNA was extracted by homogenization with Trizol reagent (Applied Biosystems, USA) in accordance with the manufacturer’s protocol. RNA quantity was determined by optical density measurement and prepared for cDNA synthesis. 3.7. Reverse transcription and semi-quantitative real- time RT-PCR The reverse transcription was conducted with a RT reagent kit (Agilent, U.S.A.) in accordance with the manufacturer’s protocol. PCR analyses were performed with gene-specific primers (Table 1), and the endogenous control was glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Real-time data were analyzed with a Mastercycler® realplex analysis system (Eppendorf, Hamburg, Germany). All samples were performed in triplicate. Thermal cycling condition was set according to the manufacturer’s recommendations. Relative quantification of target mRNA was normalized to GAPDH expression with the comparative cycle threshold (Ct) method (37). The relative fold change of target gene expression was expressed as 2-∆∆Ct, where ∆∆Ct = ∆Ct test animal −∆Ct calibrator animal. Three animals in the sham group were randomly chosen as the calibrator sample. The ∆Ct was defined as Ct target −Ct GAPDH. 3.8. Blood brain barrier permeability evaluation Blood brain barrier permeability was determined by Evans blue (EB) extravasation at day 7 post tFCI. Briefly, EB (2% in 0.01M PBS; 5 mL/kg) was slowly administered i.v. Three hours after dye administration VEIPR protects against ischemic brain injury 2479 Table 1. List of primers used in this study Gene Forward 5’-3’ Reverse 5’-3’ IL1-alpha CCAAAGTTCCTGACTTGTTTG GAAGGTGAAGGTGGACATC IL1-beta CTGTCCCTGAACTCAACTGTG GTCCTCATCCTGGAAGCTCC IL-6 CAGGGAGATCTTGGAAATGAG GTTGTTCTTCACAAACTCC iNOS GGAAGTTTCTCTTCAGAGTC CGATGGAGTCACATGCAGC COX2 GACAGATCAGAAGCGAGGACCTG GTAGATCATGTCTACCTGAGTG TNF-alpha GATCGGTCCCAACAAGGAGG GCTGGTACCACCAGTTGGTTG VCAM-1 GGCTCGTACACCATCCGC CGGTTTTCGATTCACACTCGT ICAM-1 AAACGGGAGATGAATGGTACCTAC TGCACGTCCCTGGTGATACTC GAPDH GTGAAGGTCGGTGTGAACGG GTTTCCCGTTGATGACCAG intracardiac perfusion was performed with 300 ml saline to remove intravascular EB dye. The brains were quickly removed and dissected into sections of 2 mm thickness for imaging analysis. To assess the Evans blue (EB) extravasation, these sections were soaked in methanamide for 48 hours followed by centrifugation for 30 min at 14000 rpm. The absorption of the supernatant was determined at 632 nm with a spectrophotometer (Bio-Rad). The content of EB was calculated as µg/g of brain tissue using a standard curve. 3.9. Brain water content determination At day 7 post tFCI, rats were killed by decapitation under deep chloral hydrate (360 mg/kg, i.p.) anesthesia. The brain was quickly removed and dissected along the fissure into the ischemic and non-ischemic hemispheres. Brain tissues was then weighed (wet weight), and then the brain was heated for 3 days at 100°C in a drying oven to determine the dry weight. Brain water content ipsilateral to the lesion was calculated with the following formula: % H2O = (1-dry wt/wet wt) ×100 % (38-40). 3.10. Behavioral training and evaluations 3.10.1. Neurological deficits Neurologic deficits scores were performed at beginning at day 3 through day 21 post tFCI (Figure 1) as previously described (41). Each rat was scored according to a seven points behavioral rating scale: 0, no deficit; 1, failure to extend right forepaw fully; 2, decreased grip of the right forelimb when held by tail; 3, spontaneous movement in all directions, but torso turning to the right side when held by tail; 4, circling or walking to the right; 5, walks only when stimulated; 6, no spontaneous activity; and 7, dead. Animals without a deficit were excluded from the study. An observer blinded to experiment design performed neurological testing. 3.10.2. Foot fault test Measurement of coordinated locomotor movement of rat forelimb was determined using the foot fault test as previously described with some modification (42). Briefly, on a horizontal ladder with a regular arrangement of rungs (at 2 cm intervals) all rats were trained for 4 consecutive days before tFCI, and the baseline score was determined on the day before the operation. After tFCI, the foot fault test was performed every 3 days starting from day 3 until day 21 post tFCI (Figure 1). All animals were trained and tested three times per session and every session was videotaped for quantification (only consecutive steps were analyzed). The quantitative evaluation of forelimb placement was performed using the following scoring system: Score 0, total miss, the limb completely missed the rung; Score 1, deep slip, the forelimb was placed on the rung, but slipped off and caused a fall; Score 2, slight slip, the forelimb was placed on a rung, and then slipped off but did not result in a fall and the rat continued a coordinated gait; Score 3, replacement, the forelimb was placed on a rung, but then quickly lifted and placed on another rung before it was weight bearing; Score 4, correction, the forelimb aimed for one rung, but was placed on another rung before touching the first one; Score 5, partial placement, the forelimb was placed on the rung with wrist digits; Score 6, correct placement, the forelimb was placed on the rung cor