novel genotypes of anaplasma bovis, “candidatus midichloria” sp. and ignatzschineria sp. in the rocky mountain wood tick, derm

novel genotypes of anaplasma bovis, “candidatus midichloria” sp. and ignatzschineria sp. in the rocky mountain wood tick, derm 文库 Novel genotypes of Anaplasma bovis, “Candidatus Midichloria” sp. and Ignatzschineria sp. in the Rocky Mountain wood tick, Derm Novel genotypes of Anaplasma bovis, ‘‘Candidatus Midichloria’’ sp. andIgnatzschineria sp. in the Rocky Mountain wood tick, DermacentorandersoniShaun J. Dergousoff*, Neil B. ChiltonDepartment of Biology, University of Saskatchewan, 112 Science Place, Saskatoon, Saskatchewan, Canada S7N 5E21. IntroductionAnaplasma (order Rickettsiales, family Anaplasmata-ceae) are obligate intracellular Alphaproteobacteria thatare transmitted to mammals mainly by ticks (Rymas-zewska and Grenda, 2008). Four species, A. marginale, A.centrale, A. ovis and A. bovis, are the causative agents ofbovine anaplasmosis, a disease that occurs worldwide intropical and subtropical areas and has a significant impacton cattle production (Kocan et al., 2003, 2010; Rymas-zewska and Grenda, 2008).Bovine anaplasmosis is enzootic in many parts of theUSA, including some states bordering western Canada(Kocan et al., 2003, 2010). The Rocky Mountain wood tick,Dermacentor andersoni, is the major vector western USA (Kocan et of A. marginale,the causative agent of bovine anaplasmosis in north- al., 2003, 2010). Although adult D.andersoni from western Canada have been shown to becompetent vectors for the transmission of A. marginale tocattle(Lankesteretal.,2007;Scolesetal.,2006),therehavebeen only a few isolated cases of bovine anaplasmosisin Canada, and these were subsequently eradicatedVeterinary Microbiology 150 (2011) 100–106A R T I C L EI N F OArticle history:Received 10 August 2010Received in revised form 7 January 2011Accepted 20 January 2011Keywords:Anaplasma bovisMidichloriaIgnatzschineria sp.Dermacentor andersoniBovine anaplasmosisA B S T R A C TBovine anaplasmosis, caused by Anaplasma marginale, is a vector-borne disease that isenzootic in many parts of the USA. Although Dermacentor andersoni, a major vector of A.marginale, occurs in Canada, the Canadian cattle herds are currently considered free ofbovine anaplasmosis. There have been two outbreaks of the disease in the province ofSaskatchewan, but these have been linked to the importation of infected animals.However, the distribution of bovine anaplasmosis may alter with range expansion of thevectors. The aim of the present study was to use molecular techniques to determine ifAnaplasma were present in D. andersoni at a locality near its northeastern distributionallimit in Saskatchewan. Nested PCR analyses of the bacterial 16S rRNA gene wereconducted on the total genomic DNA of 105 individual ticks. Single strand conformationpolymorphism analysis and DNA sequencing of the 11 PCR-positive amplicons revealedthepresence ofthreespeciesofbacteria,noneofwhichhavebeenpreviouslyreportedinD.andersoni. Although no ticks were infected with A. marginale, a novel genotype of A. boviswas detected in eight individuals. This discovery represents the first report of A. bovis inCanada. The potential implications of this finding with respect to animal health andanaplasmosis surveillance in Canada are discussed. The other two bacterial speciesdetected were genetically similar to ‘‘Candidatus Midichloria mitochondrii’’ andIgnatzschineria larvae, the latter of which has been associated with human disease inEurope. Further investigations are needed to 文库 文库 determine the prevalence, reservoir hosts,and pathogenicity of the Canadian genotype of A. bovis.? 2011 Elsevier B.V. All rights reserved.* Corresponding author. Tel.: +1 306 966 4407; fax: +1 306 966 4461.E-mail address: shaun.dergousoff@usask.ca (S.J. Dergousoff).Contents lists available at ScienceDirectVeterinary Microbiologyjournal homepage: www.elsevier.com/locate/vetmic0378-1135/$ – see front matter ? 2011 Elsevier B.V. All rights reserved.doi:10.1016/j.vetmic.2011.01.018 (Lankester et al., 2007; Whiting, 2005). Thus, Canadiancattle herds are considered free of the disease (Whiting,2005). Outbreaks of bovine anaplasmosis in Canada,including two occurrences in Saskatchewan, have usuallybeen associated with the importation of infected animalsfrom the USA (Whiting, 2005; CFIA, 2006). However, thedistribution of bovine anaplasmosis may change as aconsequence of range expansion by the vectors, such as D.andersoni, a tick species that appears to be expanding itsdistribution eastwards and northwards in Saskatchewan(Dergousoff et al., unpublished data). Therefore, the aim ofthe present study was to use molecular techniques to testfor the presence of Anaplasma in D. andersoni adults andnymphs from a locality near the northeastern distribu-tional limit of this tick species in Saskatchewan.2. Materials and methods2.1. Collection of ticksA total of 105 D. andersoni, 100 adults (22 males and 78females) and five nymphs, were collected from Saskatch-ewan Landing Provincial Park (50.6592N, 108.0012W) insouthern Saskatchewan. Adult ticks were collected in Mayof 2005 by flagging grass and shrubs from coulees andridges on both sides of the lake. Nymphs were collectedfrom deer mice (Peromyscus maniculatus) and meadowvoles (Microtus pennsylvanicus) captured in snap trapsduring June and July of 2008. The morphological identityofeach tick was confirmed using a PCR-based assay(Dergousoff and Chilton, 2007).2.2. DNA preparationTotal genomic DNA (gDNA) was extracted and purifiedfrom each tick using a modification of the protocol of theDNeasy Tissue KitTM(Qiagen, Valencia, USA). Individualticks were placed in 1.5ml micropestle tubes (Kontes), towhich 180ml of ATL buffer (Qiagen) was added. Ticks werehomogenized by grinding with micropestles (Kontes)attached to a cordless drill. Proteinase K (20ml @ 15mg/ml)wasaddedtothehomogenate.Sampleswereincubatedfor 16h at 55 8C. The gDNA was purified according to theDNeasy tissue kit protocol, except that gDNA was elutedtwice from the spin columns using 50ml of AE buffer. Thetwo elutions derived from the same tick were combined ina single tube and stored at ?20 8C.2.3. PCR of 16S rRNA geneThe presence of Anaplasma and Ehrlichia in D. andersoniwastestedusinganestedPCR(n-PCR).Thefirstphaseofthen-PCR targeted 1462bp of the 16S rRNA gene of Anaplasmaand Ehrlichia using primers EC9 (TACCTTGTTACGACTT) andEC12A (TGATCCTGGCTCAGAACGAACG) (Kawahara et al.,2006). PCR reactions were carried out in 25ml volumescontaining 200mM of each dNTP, 3mM MgCl2, 25pmol(1mM) of each primer, 0.5U of recombinant Taq DNApolymerase (Fermentas, Burlington, Canada), 2.5ml 10?PCRbufferwith(NH4)2SO4(Fermentas),and2mlofgDNA.Anegative control (i.e. without gDNA) was included in eachset of reactions. PCRs were performed in a thermocycler(iCyclerTM, Bio-Rad; Hercules, USA) using the followingconditions:958Cfor5min,followedby35cyclesof958Cfor30s,528Cfor30s,and728Cfor30s,andafinalextensionat748C for 5min. Two internal primers, PER1 (TTTATCGC-TATTAGATGAGCCTATG)andGAATTCCGCTAT) were used in phase two of the n-PCR toamplify 451bp of the 16S rRNA gene of all species ofAnaplasmaandEhrlichia(Munderlohetal.,1996).PCRswereconducted as in the first phase, except that 1ml of thepurified products from phase one, including those of thenegative 文库 文库 controls, were used as the DNA templates and theannealing temperature was raised to 568C. Additionalnegative controls were included in each set of PCRs.Amplicons were subjected to electrophoresis on SYBR1Safe-stained 1.5% agarose-TBE gels and their bandingpatterns were visualized by UV transillumination.PER2(CTCTACACTAG-2.4. Single-strand conformation polymorphism (SSCP)analysesThis mutatio scanning technique was used on allpositive amplicons (n = 11) derived from the second phaseof the n-PCR to differentially display DNA sequences thatdiffer by one or more nucleotides (Gasseret al., 2006). Eachamplicon (1–5ml) was mixed with DNase-free water (1–4ml) and 5ml of loading buffer (Gel Tracking DyeTM;Promega, Madison, USA). Samples were denatured at 95 8Cfor 5 min then snap cooled in ice water for 5 min prior toloading into individual wells of precast GMATMS-50 gels(Elchrom Scientific, Cham, Switzerland) that had beenplacedahorizontalSEA2000TMScientific) containing 1? TAE buffer. A temperaturecontrolled circulating water bath connected to theelectrophoretic apparatus maintained a constant tempera-ture of 7.48C for 18h, while the were subjected toelectrophoresis at 74V. Gels were stained for 30 min withSYBR1Gold samples (Invitrogen, Carlsbad, USA) then rinsed indistilled water and photographed.apparatus(Elchrom2.5. DNA sequence analyses and nucleotide sequenceaccession numbersAll PCR-positive samples were column-purified (MinE-lute DNA purification kit; Qiagen) and subjected toautomated DNA sequencing using primers PER1 andPER2 in separate reactions. The 16S rDNA sequences(404–431bp) of the 11 amplicons were manually alignedand a BLAST search was performed to determine sequencesimilarity of each sequence with those of other bacteriadeposited in GenBank. Sequences of representative sam-ples obtained in the study have been deposited inGenBank under accession numbers FN665374, FN665375and present FR667203. The phylogenetic relationships of the threebacterial species were determined using neighbor-joininganalyses of the 16S rRNA sequences of representative taxafrom different bacteria groups.The University Committee on Animal Care and Supplyat the University of Saskatchewan approved the Animalcollection protocols. Permits to trap rodents were obtainedfrom the Saskatchewan Ministry of Environment.S.J. Dergousoff, N.B. Chilton/Veterinary Microbiology 150 (2011) 100–106101 3. Results3.1. PCR detection of bacterial 16S rDNANo bands were detected on agarose gels for any of thenegative control samples from either the first or secondphase of the n-PCR. Amplicons were detected on agarosegelsfor 11(10%)ofthe105ticksamples(i.e.from1nymph,4malesand6 females)fromthe secondphaseofthen-PCR.The amplicon from one tick was approximately 475bp,while the amplicons from nine other samples wereapproximately 450 bp in size. In addition, the ampliconof another tick contained two bands (450 and 475bp),suggesting the presence of at least two types of bacteria.However, only a single bacterial species could be detectedin this amplicon when subjected to DNA sequencing. Theresultsof the SSCPanalyses (Fig. 1) showedthat there werethree distinct banding patterns (i.e. profiles) among the 10samples that produced a single band on agarose gels. DNAsequencing of these amplicons revealed that each com-prised the 16S rDNA sequence of a single bacterial species;however, the sequences of each amplicon were notidentical. Amplicons with the same SSCP profile had anidentical sequence, whereas those with different bandingpatterns had different DNA sequences.3.2. Phylogenetic analysesThe 16S rDNA sequences of all bacteria detected in thisstudy were not identical to any sequence deposited inGenBank. The sequences (404bp) of eight amplicons weremost similar (97–99%) to the 16S sequences of specieswithin the genus Anaplasma. Results 文库 文库 of a phylogeneticanalysis(Fig. 2) revealedthat the AnaplasmainD. andersoniwas placed within a clade consisting of only A. bovisgenotypes. However, the 16S rDNA sequence of the A.bovis-like organism in D. andersoni was unique because itdifferedbyfive toseven nucleotides whencomparedto thesequences of all other A. bovis genotypes. The rDNAsequence (404 bp) of another bacterium from a single D.andersoni male was 98.3% similar (i.e. 7 bp differences) tothe 16S rDNA sequence of an uncultured bacterium of theorder Rickettsiales (accession no. AF497583) derived froma tick (Haemaphysalis wellingtoni) in Thailand (Parola et al.,2003). This bacterial species in D. andersoni falls within aclade (Fig. 2) that includes ‘‘Candidatus Midichloriamitochondrii’’ and other unnamed Rickettsiales. The 16SrDNA sequences of the third bacterial species from onemale andone femaletickwere identicalto oneanother and95.8% (413 of 431bp) similar to the 16S sequence ofIgnatzschineria larvae. Itwas geneticallymost similarto theunpublished sequence of an Ignatzschineria sp. found in aswine effluent holding pit (accession no. DQ337535). Thisbacterium falls within a clade (Fig. 3) comprised ofgenotypes of Ignatzschineria and other unnamed Gamma-proteobacteria.4. DiscussionThere was no evidence of A. marginale in any of the fiveD. andersoni nymphs collected from small rodents, or the100 D. andersoni adults collected by flagging. However, A.bovis DNA was detected in eight D. andersoni (one nymph,two males and five females) using n-PCR, SSCP and DNAsequencing of the 16S rRNA gene. Furthermore, the rDNAsequence of the A. bovis detected in the nymphal tick wasidentical to those of the eight adult ticks collected threeyears earlier, indicating that this organism may beendemic at a low prevalence in the tick population and,presumably in one or more suitable vertebrate hosts. Asfar as we are aware, this represents the first publishedreport of A. bovis in Canada and in ticks of the genusDermacentor.A. bovis has been detected previously in the genomicDNA of Haemaphysalis longicornis in Korea (Lee and Chae,2010; Oh et al., 2009), Japan (Kawahara et al., 2006) andChina (Sun et al., 2008), H. concinna in Russia (Shpynovet al., 2006), H. lagrangei in Thailand (Parola et al., 2003), H.megaspinosa in Japan (Yoshimoto et al., 2010), Rhipicepha-lus evertsi in South Africa (Tonetti et al., 2009) and R.turanicus in Israel (Harrus et al., 2010). AmblyommavariegatumandR.appendiculatushavealsobeenimplicatedas vectors of A. bovis in Africa (Scott, 1994) and Hyalommasp. in Iran (Donatien and Lestoquard, 1936). A. bovisinfections of mammals are most commonly reported inungulates, such as cattle and buffalo from Africa, theMiddle East, South America, and Japan (Ooshiro et al.,2008; Uilenberg, 1993), and in deer from Japan (Kawaharaet al., 2006) and South Korea (Lee et al., 2009). In cattle, A.bovis infects monocytes (Scott, 1994; Uilenberg, 1993).Infection is often asymptomatic (Stewart, 1992), but A.bovis can cause a variety of clinical symptoms, includingfever and reduced body weight and possibly death of na? ?veor stressed cattle (Scott, 1994; Uilenberg, 1993). However,the 16S rDNA sequences of the A. bovis in D. andersoni weregenetically unique (differences of 5–7 nucleotides) whencompared to the sequences of A. bovis detected in otherstudies, including the strain found in cottontail rabbits inthe USA (Goethert and Telford, 2003). It will be importantto determine if this novel genotype of A. bovis in D.andersoni is transmissible to cattle, if it has an impact onthe health of livestock, and its prevalence in differentgeographical areas.Fig. 1. SSCP analysis of the bacterial 16S rDNA amplicons from n-PCR ofgDNA from D. andersoni. Banding patterns in Lanes 1–8 represent rDNAfromA.bovis,lane 9from‘‘Candidatus Midichloriamitochondrii’’,and lane10 from Ignatzschineria sp.S.J. Dergousoff, N.B. Chilton/Veterinary Microbiology 150 (2011) 100–106102 文库 文库 The discovery of A. bovis DNA in host-seeking D.andersoni adults may have important implications foranaplasmosis surveillance inCanada, the aim ofwhich istokeep Canadian cattle herds free of infection with A.marginale. There is a significant economic cost (i.e. reducedanimal production and compensation costs for quarantineand destruction of infected livestock) associated withdiagnosed cases of bovine anaplasmosis in Canada(Whiting, 2005). Given this, it is essential that there arediagnostic tests that unequivocally distinguish betweencattle infected with A. marginale from those infected withA. bovis, or other species within the family Anaplasmata-ceae. The diagnostic tests used to screen blood from cattleto detect the presence of and/or exposure to A. marginaleinclude the MSP5 competitive-inhibition enzyme-linkedimmunosorbent assay (cELISA) and a nested PCR of themsp5 gene (Torioni de Echaide et al., 1998; Van Donkers-goed et al., 2004). The MSP5 protein is highly conserved inA. marginale, A. centrale, A. ovis and A. phagocytophilum (dela Fuente et al., 2005), but it has not been characterized inA. bovis. Studies have shown that some of the diagnostictests used to detect animals infected with A. marginalecross-react with other Anaplasma species (Molloy et al.,1999; Dreher et al., 2005; Scoles et al., 2008). However, it isunknown if the tests used to identify A. marginale infectedcattle and bison will also detect animals exposed to A.bovis. Therefore, more work is needed to determine if thepresence of A. bovis in D. andersoni represents a complicat-Fig. 2. Phylogenetic tree depicting the position of the two different Alphaproteobacteria detected in D. andersoni relative to representative taxa within theorder Rickettsiales based on a neighbor-joining analysis of the 16S rRNA gene. The GenBank accession number for each sequence is indicated (in brackets).Numbers above branches are bootstrap values. Rickettsia rickettsii (accession number CP000766) was used as the outgroup (Epis et al., 2008). The barrepresents 0.01 inferred substitutions per nucleotide site.S.J. Dergousoff, N.B. Chilton/Veterinary Microbiology 150 (2011) 100–106103 ing factor for the bovine anaplasmosis surveillanceprogram in Canada.Although the primers used in the n-PCR were designed(Kawahara et al., 2006; Munderloh et al., 1996) to amplifythe 16S rDNA sequences of Anaplasma and Ehrlichiaspecies, our results showed that they were able toamplify16S rDNA of two other bacterial species from thegDNA of D. andersoni adults. The 16S rDNA sequence of onespecies found in a single male tick most closely resembled(98% similar) the 16S sequence of uncultured bacteria(strains Hw124 and Hw191) from two Haemaphysaliswellingtoni nymphs collected from red jungle fowl (Gallusgallus) in Thailand (Parola et al., 2003). Phylogeneticanalyses of the 16S sequences of representative taxawithin the order Rickettsiales revealed that this bacterialspecies falls within a clade that includes the bacterialstrains Hw124 and Hw191 and the different strains of‘‘Candidatus Midichloria mitochondrii’’ reported in severalspecies of tick (Epis et al., 2008). This clade represents asister group to the family Anaplasmataceae and appears torepresentanovel familyofAlphaproteobacteria(Episetal.,2008), but the veterinary significance of the group remainsto be determined. The bacterium detected in D. andersonimay also be a member of this genus given the 97%similarity in 16S rDNA sequence (i.e. 394 of 404 bp) to the‘‘Candidatus Midichloria mitochondrii’’ strain in Ixodesricinus (GenBank accession no. AJ566640). This would,therefore, represent the first report of such an organism ina North American species of Dermacentor.The other bacterial species amplified by n-PCR from thegDNA of one female and one male D. andersoni was agammaproteobacterium. The16S rDNA sequence of thisbacterium was 96% similar to the 16S sequence ofIgnatzschineria (syn. Schineria) larvae and belonged 文库 文库 withina clade comprising isolates of Ignatzschineria, to theexclusion of other Gammaproteobacteria. Ignatzschinerialarvae was first isolated from larvae of the parasitic flyWohlfahrtia magnifica (To ′th et al., 2001). Therefore, ourstudy probably represents the first report of the detectionof Ignatzschineria in ticks. Given that Ignatzschineria hasalso been shown to be associated with human infections inFrance (Roudiere et al., 2007), it will be important toFig. 3. Phylogenetic tree depicting the position of the gammaproteobacterium detected in two adult D. andersoni relative to representative taxa ofGammaproteobacteria based on a neighbor-joining analysis of the 16S rRNA gene. The GenBank accession number for each sequence is indicated (inbrackets). Numbers above branches are bootstrap values. Legionella pneumophila (accession number AF129523) was used as the outgroup. The barrepresents 0.01 inferred substitutions per nucleotide site.S.J. Dergousoff, N.B. Chilton/Veterinary Microbiology 150 (2011) 100–106104 determine if the Ignatzschineria sp. in D. andersoni is ofanimal and/or human health significance.In conclusion, novel genotypes of A. bovis, ‘‘CandidatusMidichloria’’ sp. (Alphaproteobacteria) and Ignatzschineriasp. (Gammaproteobacteria) were all amplified by n-PCRfrom the gDNA of D. andersoni. The three bacterial speciescould be readily distinguished from one another usingSSCP analyses of the 16S rRNA gene. More work is neededto genetically characterize this novel genotype of A. bovisand to determine its prevalence, reservoir hosts, patho-genicity and relative importance to the Canadian surveil-lance program for bovine anaplasmosis.AcknowledgementsFunding for this work was provided to NBC from theNatural Sciences and Engineering Research Council ofCanada (NSERC) and the Canadian Foundation for Innova-tion. SJD received funding through a NSERC PostgraduateScholarship. We would like to thank Kathrin Sim fortechnical assistance and the park superintendent and stafffrom Saskatchewan Landing Provincial Park for theirpermission and help in the collection of specimens.ReferencesCanadian Food Inspection Agency, 2006. Reviewing the Canadian FoodInspection Agency’s Import Policy for Anaplasmosis for RuminantAnimals Imported from the United States. , 74 pp.de la Fuente, J., Lew, A., Lutz, H., Meli, M.L., Hofmann-Lehmann, R., Shkap,V., Molad, T., Mangold, A.J., Almaza ′n, C., Naranjo, V., Gorta ′zar, C.,Torina, A., Caracappa, S., Garc? ′a-Pe ′rez, A.L., Barral, M., Oporto, B., Ceci,L., Carelli, G., Blouin, E.F., Kocan, K.M., 2005. Genetic diversity ofAnaplasma species major surface proteins and implications for ana-plasmosis serodiagnosis and vaccine development. Anim. Health Res.Rev. 6, 75–89.Dergousoff, S.J., Chilton, N.B., 2007. Differentiation of three species ofixodid tick, Dermacentor andersoni, D. variabilis and D. albipictus, byPCR-based approaches using markers in ribosomal DNA. Mol. Cell.Probes 21, 343–348.Donatien, A., Lestoquard, F., 1936. Rickettsia bovis, nouvelle espe ′ce patho-ge ′ne pour le beouf. Bull. Acad. Pathol. Exot. 29, 1057–1061.Dreher, U.M., de la Fuente, J., Hofmann-Lehmann, R., Meli, M.L., Pusterla,N., Kocan, K.M., Woldehiwet, Z., Braun, U., Regula, G., Staerk, K.D.C.,Lutz, H., 2005. Serologic cross-reactivity between Anaplasma margin-ale and Anaplasma phagocytophilum. Clin. Diagn. Lab. Immunol. 12,1177–1183.Epis, S., Sassera, D., Beninati, T., Lo, N., Beati, L., Piesman, J., Rinaldi, L.,McCoy,K.D.,Torina, A.,Sacchi, L.,Clementi,E., Genchi,M.,Magnino, S.,Bandi, C., 2008. Midichloria mitochondrii is widespread in hard ticks(Ixodidae) and resides in the mitochondria of phylogeneticallydiverse species. Parasitology 35, 485–494.Gasser, R.B., Hu, M., Chilton, N.B., Campbell, B.E., Jex, A.J., Otranto, D.,Cafarchia, C., Beveridge, I., Zhu, X., 2006. Single-strand conformationpolymorphism(SSCP)fortheanalysisofgeneticvariation.Nat.Protoc.1, 文库 文库 3121–3128.Goethert, H.K., Telford III, S.R., 2003. Enzootic transmission of Anaplasmabovis in Nantucket cottontail rabbits. J. Clin. Microbiol. 41, 3744–3747.Harrus, S., Perlman-Avrahami, A., Mumcuoglu, K.Y., Morick, D., Eyal, O.,Baneth, G., 2010. Molecular detection of Ehrlichia canis, Anaplasmabovis, Anaplasma platys, Candidatus Midichloria mitochondrii andBabesia canis vogeli in ticks from Israel. Clin. Microbiol. Infect,doi:10.1111/j.1469-0691.2010.03316.x.Kawahara, M., Rikihisa, Y., Lin, Q., Isogai, E., Tahara, K., Itagaki, A.,Hiramitsu, Y., Tajima, T., 2006. Novel genetic variants of Anaplasmaphagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novelEhrlichia sp. in wild deer and ticks on two major islands in Japan.Appl. Environ. Microbiol. 72, 1102–1109.Kocan, K.M., de la Fuente, J., Blouin, E.F., Coetzee, J.F., Ewing, S.A., 2010.The natural history of Anaplasma marginale. Vet. Parasitol. 167,95–107.Kocan, K.M., de la Fuente, J., Guglielmone, A.A., Melendez, R.D., 2003.AntigensandalternativesforcontrolofAnaplasmamarginaleinfectionin cattle. Clin. Microbiol. Rev. 16, 698–712.Lankester, M.W., Scandrett, W.B., Golsteyn-Thomas, E.J., Chilton, N.C.,Gajadhar, A.A., 2007. Experimental transmission of bovine anaplas-mosis (caused by Anaplasma marginale) by means of Dermacentorvariabilis and D. andersoni (Ixodidae) collected in western Canada.Can. J. Vet. Res. 71, 271–277.Lee, M.-J., Chae, J.-S., 2010. Molecular detection of Ehrlichia chaffeensis andAnaplasma bovis in the salivary glands from Haemaphysalis longicornisticks. Vector Borne Zoonotic Dis. 10, 411–413.Lee, M., Yu, D., Yoon, J., Li, Y., Lee, J., Park, J., 2009. Natural co-infection ofEhrlichia chaffeensis and Anaplasma bovis in a deer in South Korea. J.Vet. Med. Sci. 71, 101–103.Molloy, J.B., Bowles, P.M., Knowles, D.P., McElwain, T.F., Bock, R.E., King-ston, T.G., Blight, G.W., Dalgliesh, R.J., 1999. Comparison of a compe-titive inhibition ELISA and the card agglutination test for detection ofantibodies to Anaplasma marginale and Anaplasma centrale in cattle.Aust. Vet. J. 77, 245–249.Munderloh, U.G., Madigan, J.E., Dumler, J.S., Goodman, J.L., Hayes, S.F.,Barlough, J.E., Nelson, C.M., Kurtti, T.J., 1996. Isolation of the equinegranulocytic ehrlichiosis agent, Ehrlichia equi, in tick cell culture. J.Clin. Microbiol. 34, 664–670.Oh, J.Y., Moon, B.-C., Bae, B.K., Shin, E.H., Ko, Y.H., Kim, Y.-J., Park, Y.H.,Chae, J.-S., 2009. Genetic identification and phylogenetic analysis ofAnaplasmaandEhrlichiaspeciesinHaemaphysalislongicorniscollectedfrom Jeju Island, Korea. J. Bacteriol. Virol. 39, 257–267.Ooshiro, M., Zakimi, S., Matsukawa, Y., Katagiri, Y., Inokuma, H., 2008.Detection of Anaplasma bovis and Anaplasma phagocytophilum fromcattle on Yonaguni Island, Okinawa, Japan. Vet. Parasitol. 154,360–364.Parola, P.,Cornet,J.-P., Sanogo,Y.O., Miller,R.S.,Thien, H.V.,Gonzalez, J.-P.,Raoult, D., Telford III, S.R., Wongsrichanalai, C., 2003. Detection ofEhrlichia spp., Anaplasma spp., Rickettsia spp., and other eubacteria inticks from the Thai-Myanmar border and Vietnam. J. Clin. Microbiol.41, 1600–1608.Roudiere, L., Jean-Pierre, H., Comte, C., Zorgniotti, I., Marchandin, H.,Jumas-Bilak, E., 2007. Isolation of Schineria sp. from a man. Emerg.Infect. Dis. 13, 659–661.Rymaszewska, A., Grenda, S., 2008. Bacteria of the genus Anaplasma –characteristics of Anaplasma and their vectors: a review. Vet. Med. 53,573–584.Scoles, G.A., Goff, W.L., Lysyk, T.J., Lewis, G.S., Knowles, D.P., 2008.Validation of an Anaplasma marginale cELISA for use in the diagnosisof A. ovis infections in domestic sheep and Anaplasma spp. in wildungulates. Vet. Microbiol. 130, 184–190.Scoles, G.A., McElwain, T.F., Rurangirwa, F.R., Knowles, D.P., Lysyk, T.J.,2006. A Canadian bison isolate of Anaplasma marginale (Rickettsiales:Anaplasmataceae) is not transmissible by Dermacentor andersoni(Acari: Ixodidae), whereas ticks from two Canadian D. andersonipopulations are 文库 文库 competent vectors of a US strain. J. Med. Entomol.43, 971–975.Scott, G.R., 1994. Lesser-known rickettsias infecting livestock. In: Coet-zer, J.A.W., Thomson, G.R., Tustin, (Eds.), Infectious Diseasesof Livestock, vol. 1. Oxford University Press, Oxford, UK, R.C. pp.371–377.Shpynov, S., Fournier, P.E., Rudakov, N., Tarasevich, I., Raoult, D., 2006.Detection of members of the genera Rickettsia, Anaplasma, andEhrlichia in ticks collected in the Asiatic part of Russia. Ann. N. Y.Acad. Sci. 1078, 378–383.Stewart, C.G., 1992. Bovine ehrlichiosis. In: Fivaz, B., Petney, T., Horak, I.(Eds.), Tick Vector Biology: Medical and Veterinary Aspects. Springer-Verlag, New York, pp. 101–107.Sun,J.,Liu,Q.,Lu,L.,Ding,G.,Guo,J.,Fu,G.,Zhang,J.,Meng,F.,Wu,H.,Song,X., Ren, D., Li, D., Guo, Y., Wang, J., Li, G., Liu, J., Lin, H., 2008.Coinfection with four genera of bacteria (Borrelia, Bartonella, Ana-plasma, and Ehrlichia) in Haemaphysalis longicornis and Ixodes sinen-sis ticks from China. Vector Borne Zoonotic Dis. 8, 791–796.Tonetti, N., Berggoetz, M., Ruhle, C., Pretorius, A.M., Gern, L., 2009. Ticksand tick-borne pathogens from wildlife in the free state province,South Africa. J. Wildl. Dis. 45, 437–446.Torioni de Echaide, S., Knowles, D.P., McGuire, T.C., Palmer, G.H., Suarez,C.E., McElwain, T.F., 1998. Detection of cattle naturally infected withAnaplasma marginale in a region of endemicity by nested PCR and acompetitive enzyme-linked immunosorbent assay using -nant major surface protein 5. J. Clin. Microbiol. 36, 777–782.Torecombi ′th, E., Kova ′cs, G., Schumann, P., Kova ′cs, A.L., Steiner, U., Halbritter, A.,Ma ′rialigeti, K., 2001. Schineria larvae gen. nov., sp. nov., isolated fromthe 1st and 2nd larval stages of Wohlfahrtia magnifica (Diptera:Sarcophagidae). Int. J. Syst. Evol. Microbiol. 51, 401–407.S.J. Dergousoff, N.B. Chilton/Veterinary Microbiology 150 (2011) 100–106105 Uilenberg, G., 1993. Other ehrlichioses of ruminants. In:Z., Ristic, M. (Eds.), Rickettsial and Chlamydial Diseases of Domes-tic Animals. Pergamon Press, Tarrytown, New York, pp. 269–279.VanDonkersgoed,J.,Gertonson,A.,Bridges,M.,Raths,D.,Dargatz,D.,Wagner,B.,Boughton,A.,Knoop,D.,Walton,T.E.,2004.Prevalenceofantibodiestobluetongue virus and Anaplasma marginale in Montana yearling cattleentering Alberta feedlots: Fall 2001. Can. Vet. J. 45, 486–492.Woldehiwet,Whiting, T., 2005. Anaplasmosis, animal welfare, and bilateral tradebetween Canada and the USA. Can. Vet. J. 46, 935–941.Yoshimoto, K., Matsuyama, Y., Matsuda, H., Sakamoto, L., Matsumoto,K., Yokoyama, N., Inokuma, H., 2010. Detection of Anaplasma bovisandAnaplasmaphagocytophilummegaspinosainHokkaido,Japan.172.DNAVet.fromParasitol.Haemaphysalis168,170–S.J. Dergousoff, N.B. Chilton/Veterinary Microbiology 150 (2011) 100–106106 文库